miR-31 inhibits proliferation and promotes apoptosis of osteosarcoma cells through PAX9

Le-Meng Chao, Jian-Feng Liu

Inner Mongolia People’s Hospital, Spine Surgery, Hohhot, Inner Mongolia, 010000

Keywords:

ABSTRACT

1. Introduction

Osteosarcoma is the most common primary bone tumor in children and adolescents [1, 2]. In the past, clinicians used a variety of methods to treat osteosarcoma. However, the overall 5-year survival rate did not improve significantly [3]. Therefore, it is very important to understand the molecular mechanism of osteosarcoma for the development of effective treatment strategies.

Recently, large number of microRNA (miRNA) (miR-34a [4], miR-187 [5], miR-376c [6], miR-874 [7], miR-200c [8]) have been found to be significantly related to the progress and metastasis of osteosarcoma. MiR-31 is one of the frequently changed miRNAs in human cancer. A large number of studies have shown that miR-31 is specifically expressed in prostate cancer [9], gastric cancer [10], cervical cancer [11] and breast cancer [12], and miR-31 plays an important role in tumor metastasis. However, the role of miR-31 in osteosarcoma remains unclear.

In order to explore the potential mechanism of miR-31 in osteosarcoma cell lines, we used miRanda and TargetScan methods to predict its target genes according to sequence complementarity. PAX9 is an important candidate gene. Human PAX9 is located in the region of 14q12-q13 chromosome. It contains 128 amino acid DNA binding and pairing domains and makes sequence specific contact with DNA. In the past decade, the abnormal expression of PAX9 gene has been observed in a variety of malignant tumors [13], which is related to the occurrence, development, invasion and metastasis of a variety of cancers [14]. Therefore, we predict that miR-31 can inhibit the proliferation of osteosarcoma cells and promote the apoptosis of osteosarcoma cells by inhibiting PAX9.

2. Materials and methods

2.1 Tissue samples

From April 2007 to April 2017, 43 osteosarcoma tissues and paired paracancerous bone tissues were collected from osteosarcoma patients who underwent surgery in Inner Mongolia People's Hospital and Zhongshan Hospital Affiliated to Dalian University. All 43 cases had definite pathological diagnosis. According to the TNM classification of UICC, the clinical stages were determined. The study was approved by the medical ethics committee of Inner Mongolia People's Hospital and Zhongshan Hospital Affiliated to Dalian University.

2.2 Cell culture

Human osteosarcoma cell line MG-63 was cultured in DMEM. 10% (V / V) fetal bovine serum, 100 IU / ml penicillin and 100 mg / ml streptomycin were added to all media. MG-63 cells were cultured at 37 ℃.

2.3 miR-31 target gene prediction

MiRanda and TargetScan methods were used to predict miRNA target genes. The target genes predicted by the two methods are included in the further analysis.

2.4 Plasmid construction

PAX9 fragment containing miR-31 binding site was amplified and cloned into pmirGLO vector to obtain pmirGLO-pax9-wild-type (pmirGLO-pax9-wt). PmirGLO-pax9-mutant-type (pmirGLO-pax9-mut) [15]. The above plasmids were used for the following luciferase analysis.

PAX9 fragment containing miR-31 binding site was amplified and cloned into KpnI and xhoi restriction sites of pcDNA3.1 vector to synthesize pcDNA3.1-PAX9 wild type (pcdna3.1-pax9-wt) and pcDNA3.1-PAX9 mutant (pcDNA3.1-PAX9-mut) [16]. PAX9 overexpression cell model was constructed with these two plasmids.

2.5 Transfection

MG63 osteosarcoma cells were seeded in 24 well plates with a density of 5 × 105 cells / well, and then incubated overnight. According to the instructions of the manufacturer, miR-31 mimics, miR-31 inhibitor and plasmids were transfected into osteosarcoma cells by Lipofectamine 2000. The total RNA and protein were isolated from MG63 osteosarcoma cells 48 hours after transfection. The sequence of PAX9 siRNA is as follows: siRNA1 (5'- GAAGAAGCACGT TCAGGCGTCAAGA -3'); siRNA2 (5'- CACGTTCAGGCGTCAAGACCGATTT -3'); siRNA3 (5'- CGTTCAGGCGTCAAGACCGATTTCT -3').

2.6 Cell proliferation experiment

The proliferation of MG63 osteosarcoma cells was measured by CCK-8 (Dojindo, Kumamoto, Japan). MG63 osteosarcoma cells were seeded in 96 well plates with a density of 2000 cells / well. MG63 osteosarcoma cells were then incubated in 10% CCK-8. Incubate in the incubator at 37 ℃ for 2 hours. The optical density was measured at 450 nm. After transfection, the proliferation rate of MG63 osteosarcoma cells was measured at 24, 48, 72 and 96 h.

2.7 Flow cytometry

MG-63 cells of 3 × 105were inoculated into each hole of the 6-well plate, and MG-63 cells were treated with negative control (NC), miR-31 mimics, miR-31 inhibitor, PAX9 siRNA respectively. After incubation for 48 hours, the cells were digested with trypsin, washed twice with PBS, and the supernatant was discarded. The cells were mixed with 185 μ L 1 × binding buffer. Then, 5 μL annexin-V FITC and 10 μL propidium iodide (PI) were added to the suspension and incubated in darkness at room temperature for 10 minutes. Add 300 μL of 1 × binding buffer. Then FACS flow cytometry was used for measurement. The fluorescent color was detected by 530 nm and 585 nm band-pass filters, and displayed by the point graph of annexin V / FITC (Y-axis) and PI (x-axis).

2.8 Real time quantitative PCR

The total RNA of osteosarcoma tissues or cells was extracted with Trizol according to the instructions. The expression of miRNA and gene was determined by qRT-PCR using StepOne Plus real-time PCR system and SYBR Green kit. U6 and β - actin were used as internal controls. All reactions were repeated three times. The relative expression of miRNAs and genes was quantified. The primers were synthesized by Biotechnology Co., Ltd. and their sequences are as follows: PAX9: F-5’- CAGCTCGATTAGTCGGATCCT-3’, R-5’- GTACTTTAGTCCCTGTGGCTG-3’.U6 F-5’-CTCGCTTCGGCA GCACA-3’ , R-5’-AACGCTTCA CGAATTTGCGT-3’.miR-31 F-5'-TAATACTGCCTGGTAATGATGA -3’ , RT-5’-GTCGTAT CCAGTGCAGGGTCCGAGGTAT TCGCAC TGGATACGACA GCTAT-3’.β-actin F-5’-ATGATATCGCC GCGCTCG-3’, R-5’-CGCTCGGTGA GGATCTTCA-3’).

2.9 Western blotting

The total protein of osteosarcoma tissues and cells was extracted. After 10% SDS-PAGE electrophoresis, the membrane was transferred to PVDF membrane, sealed with 5% skimmed milk, and then incubated with PAX9 antibody and β - actin antibody at 4 ℃ overnight. Then the membrane was incubated with two antibodies at room temperature for 1h. Enhanced chemiluminescence (ECL) system was used to detect immunoreactive protein bands. Image plus Pro 6 software was used for semi-quantitative analysis.

2.10 Luciferase reporter gene experiment

PAX9 fragment containing miR-31 binding site was amplified and cloned into pmirGLO vector to obtain pmirGLO-PAX9-wild-type (pmirglo-PAX9-wt). Pmirglo-PAX9-mutant-type (pmirGLO-PAX9-mut) was synthesized by mutating the putative binding site of miR-31 in PAX9 with QuikChange fixed point mutation kit. The above plasmids were used for the following luciferase analysis.

MG63 osteosarcoma cells were seeded in 24 well plates with a density of 5 × 105 cells / well. Then incubate for 24 hours. MG63 osteosarcoma cells were co-transfected with pmirGLO-PAX9-wt / pmirGLO-PAX9-mut plasmid, 200nM miR-31 mimics, miR-31 mimics control and Lipofectamine 2000 in luciferase reporter gene detection. After 24 hours of transfection, double Luciferase Report detection system was used to evaluate the change of fluorescence intensity.

2.11 Statistical analysis

Spss19.0 was used for statistical analysis. All results were expressed as mean ± SD. Pearson's chi square test was used to analyze the relationship between miR-31 and clinical and pathological features. Kaplan Meier method was used to calculate survival curve data. T test is used for comparison of two groups of data, and ANOVA is used for comparison of more than two groups of data. When the variance is the same, we use Tukey test, and when the variance is not the same, we use tamhane T2 test. P value ＜ 0.05 was considered statistically significant.

3. Results

3.1 Relationship between miR-31 and clinical and pathological characteristics of osteosarcoma patients

The expression of miR-31 in 43 pairs of osteosarcoma tissues and matched paracancerous bone tissues was detected by real-time quantitative PCR. The results of real-time quantitative PCR showed that the expression of miR-31 in osteosarcoma was significantly lower than that in paired paracancerous bone (Fig.1) (t = -15.115, P = 0.000). We sought to assess whether miR-31 was associated with the final survival of osteosarcoma. Our Kaplan Meier analysis and log rank test showed that the high expression of miR-31 was related to the overall survival rate of patients with osteosarcoma (Figure 2) (chi square value = 96.975, P = 0.000). According to the relative expression of miR-31 in osteosarcoma tissues of all patients, we artificially divided those with relative expression more than 2.5 into high expression group and those with relative expression less than 2.5 into low expression group. Further analysis of Pearson's chi square test showed that there was no significant difference in the proportion of high expression of miR-31 between different ages (chi square value = 0.02, P = 0.888), genders (chi square value = 0.085, P = 0.771), and tumor diameters (chi square value = 6.514, P = 0.782). However, the proportion of high expression of miR-31 in patients with low clinical stage was significantly higher than that in patients with high clinical stage (chi square value = 3.954, P = 0.011). Similarly, the proportion of overexpression in patients without distal metastasis was significantly higher than that in patients with distal metastasis (chi square value = 0.077, P = 0.047) (Table 1).

Fig.1 Compared with osteosarcoma, matched precancerous bone tissue showed higher level of miR-31

Fig.2 The relationship between the expression of miR-31 and the survival time of patients with osteosarcoma. The survival time of patients with higher miR-31 level is longer.

Tab 1. Association of miR-31 expression with clinic pathological features of osteosarcoma

3.2 miR-31 can inhibit the proliferation and promote the apoptosis of osteosarcoma cell line

After miR-31 mimics and miR-31 inhibitor were transfected into MG63 cells, miR-31 mimics increased the expression of miR-31, and miR-31 inhibitor inhibited the expression of miR-31 (Fig.3) (F = 470.509, P = 0.000). We studied the effect of miR-31 on the proliferation and apoptosis of osteosarcoma cell line MG63. CCK-8 showed that there was no significant difference between the three groups at 24 hours (F = 0.209, P = 0.817) and 48 hours (F = 0.557, P = 0.600). At 72 hours, miR-31 mimics inhibited the proliferation of MG63 osteosarcoma cells, and miR-31 inhibitor significantly promoted the proliferation of MG63 osteosarcoma cells (F = 103.032, P = 0.000). At 96 hours, the difference remained (F = 31.419, P = 0.001) (Figure 4). The apoptosis experiment showed that compared with the negative control group, the apoptosis of miR-31 mimics group increased significantly, and the apoptosis of miR-31 inhibitor group decreased significantly (F = 372.723, P = 0.000) (Figure 5).

Fig.3 miR-31 mimics increased the expression of miR-31, however miR-31 inhibitor inhibited the expression of miR-31

Fig.4 miR-31 mimics can inhibit cell proliferation, and miR-31 inhibitor can promote cell proliferation

Fig.5 miR-31 mimics can promote apoptosis of MG63, and miR-31 inhibitor can inhibit apoptosis of MG63

3.3 miR-31 directly affects PAX9 gene and inhibits its expression

In order to explore the downstream target of miR-31, two online algorithms TargetScan (http://www.targetscan.org/) and miRanda (http://www.microrna.org/microrna/home.do) were used for bioinformatics analysis. PAX9 is considered to be a putative target gene. According to the prediction of TargetScan and miRanda, there is complementarity between the 3'untranslated region (UTR) of miR-31 and PAX9 (Figure 6).

We then demonstrated whether miR-31 miRNA mimics and miR-31 inhibitor could affect PAX9 expression. Through real-time quantitative PCR and immunoblotting experiments, we showed that miR-31 mimics significantly inhibited PAX9 gene and protein expression, while miR-31 inhibitor significantly increased PAX9 gene (F = 81.467, P = 0.000) and protein (F = 119.583, P = 0.000) expression compared with the control group (Figure 7, figure 8).

In order to further prove that miR-31 can directly affect PAX9 expression, we carried out luciferase report experiment. The results showed that miR-31 mimics could inhibit the luciferase activity of wild-type PAX9 plasmid, but had no effect on the luciferase activity of mutant PAX9 plasmid (t = -8.960, P = 0.001) (Fig.9). These results indicate that miR-31 directly acts on PAX9 gene to inhibit its expression.

Fig.6 miR-31 and PAX9-3'-UTR binding sites

Fig.7 miR-31 mimics decreased the protein level of PAX9, and miR-31 inhibitor increased the protein level of PAX9

Fig.8 miR-31 mimics inhibited PAX9 gene expression, and miR-31 inhibitor promoted PAX9 gene expression

Fig.9 Compared with the control group, miR-31 miRNA mimics and pmirGLO-PAX9-wt co-transfection group showed lower fluorescence intensity. However, there was no significant difference in fluorescence intensity between the miR-31 and pmirGLO-PAX9-mut co-transfected group and the control group

3.4 PAX9 promotes the proliferation of osteosarcoma cells and inhibits the apoptosis of osteosarcoma cells

We have shown that miR-31 can directly affect PAX9 and inhibit its expression. We further demonstrated the role of PAX9 gene in osteosarcoma cells. First, we examined the expression of PAX9 in osteosarcoma and paracancerous tissues. We observed that PAX9 gene was highly expressed (t = -12.583, P = 0.000) compared with that in paracancerous tissues (Fig.10). Then we downregulated and upregulated PAX9 gene expression by PAX9 siRNA and PAX9 overexpression plasmid respectively. We found that PAX9 siRNA downregulated the expression of PAX9 gene and protein, and PAX9 overexpression plasmid upregulated the expression of PAX9 gene (F = 27.286, P = 0.001) and protein (F = 333.638, P = 0.000) (Figure 11, Figure 12). CCK-8 showed that there was no significant difference in cell proliferation between the three groups at 24 hours (F = 0.600, P = 0.579) and 48 hours (F = 1.075, P = 0.399). At 72 hours and 96 hours, the up-regulation of PAX9 expression significantly promoted cell proliferation (F = 35.466, P = 0.000), while the down-regulation of PAX9 expression significantly inhibited cell proliferation (F = 85.271, P = 0.000) (Fig.13). Through the apoptosis experiment, we found that down regulating the expression of PAX9 gene can promote the apoptosis of osteosarcoma cells (F = 632.536, P = 0.000) (Figure 14). However, up regulation of PAX9 gene expression can play the opposite role.

Fig.10 PAX9 gene expression is higher in osteosarcoma tissue than in precancerous bone tissue

Fig.11 PAX9 siRNA and PAX9 overexpression plasmid can down regulate and up regulate PAX9 gene expression respectively

Fig.12 PAX9 siRNA and PAX9 overexpression plasmid can increase and decrease the protein level of PAX9 respectively

Fig.13 Down regulation of PAX9 gene expression can inhibit the proliferation of osteosarcoma cells, and up regulation of PAX9 gene can promote the proliferation of osteosarcoma cells

Fig.14 Down regulation of PAX9 gene expression can promote apoptosis of osteosarcoma cells, up regulation of PAX9 gene can inhibit apoptosis of osteosarcoma cells

4. Discussion

More and more evidences show that noncoding RNA plays a key role in tumor development [17]. Non coding RNA is generally divided into miRNA and LncRNA by length [18]. MiRNA, 20-200 nucleotides in length, regulates gene expression at the post transcription / translation level [19]. In recent years, it has been found that miRNA plays an important role in the pathogenesis of various cancers. MiR-31 is a new tumor associated miRNA, which has recently been found to play an important role in different cancers. MiR-31 down regulated the apoptosis of prostate cancer cells [9]. In gastric cancer, researchers found that miR-31 can inhibit tumor through epigenetic mechanism [10]. Wang et al found that miR-31 can promote the transdifferentiation of cervical cancer epithelial cells through BaP1 [11]. In another study, miR-31 can promote tumorigenesis by inhibiting the antagonists of Wnt signaling pathway [12]. It can be seen that miR-31 plays an important role in the development of various tumors, but the relationship between miR-31 and osteosarcoma has not been reported.

This study analyzed the expression pattern of miR-31 in osteosarcoma. We found that the content of miR-31 in osteosarcoma was lower than that in periosteosarcoma. Our in vitro cell experiments also showed that miR-31 could inhibit the proliferation and promote apoptosis of osteosarcoma cell line MG63.

Further prediction shows that miR-31 can directly affect PAX9 gene in theory. Through further experiments, we found that miR-31 can affect the expression of PAX9, indicating that miR-31 may directly affect PAX9 gene. Through further luciferase experiments, we proved the direct effect.

PAX9 is a transcription factor of Pax family, characterized by DNA binding paired domain [20]. Recently, the abnormal expression of PAX9 gene has been observed in a variety of malignant tumors, which is related to the occurrence, development, invasion and metastasis of a variety of cancers [21]. According to the prediction, we found that miR-31 may affect the expression of PAX9 protein. It had been reported that PAX9 is involved in the development of some tumors. In order to prove that PAX9 is also involved in the development of osteosarcoma, we investigated the role of PAX9 in osteosarcoma cells by up regulating and down regulating its expression. We found that PAX9 can promote the proliferation of osteosarcoma cells and inhibit the apoptosis of osteosarcoma cells. In conclusion, miR-31 decreased significantly in human osteosarcoma, which may be related to poor prognosis. MiR-31 provides a potential target for the treatment of osteosarcoma by directly acting on PAX9 to inhibit the proliferation of osteosarcoma cells and promote the apoptosis of osteosarcoma cells.