Effect of glycogen synthase kinase 3β on treatment of corticosteroneinduced depression in mice treated with Xiaobuxintang-2

Tian-Yu Zou, Kazuo Sugimoto, Jie-Lin Zhang, Wei-Ping Cheng

1. Heilongjiang University of Chinese medicine, 150040 Harbin, Heilongjiang

2. Beijing University of Chinese medicine,100029 Beijing

3. Heilongjiang Provincial Hospital(Harbin Institute of Technology),150036 Harbin, Heilongjiang

Keywords:

ABSTRACT

1. Introduction

Xiaobuxin-tang (XBXT) is a famous prescription of traditional Chinese medicine. It comes from the suicide note of the mogao grottoes in dunhuang, which is helpful to nourish the mind and calm the mind [1]. Studies have shown that xiaobuxin decoction has good antidepressant activity, and further purification revealed that total flavone (xbxt-2) from its ethanol extract is the active component of its antidepressant, which has a good therapeutic effect on a variety of depressed animal models, but its potential mechanism of action remains to be clarified [2]. Glycogen synthase kinase-3 (GSK3) an evolutionarily conserved serine/threonine kinase that is ubiquitous in mammalian eukaryotic cells [3]. In addition, GSK3 is a protein kinase involved in neuronal regulation and is a potential pharmacological target for the treatment of major depression. Early studies have shown that lithium at treatment concentrations can inhibit the expression of gsk-3 in the central nervous system [4]. Behavioral studies in rodent models suggest that gsk-3 is an important regulator of emotion-related behavior [5]. However, previous studies have analyzed changes in the entire brain through systemic overexpression of gsk-3, rather than specific changes in the hippocampal dentate gyrus. This study hypothesized that GSK3 overexpression in the hippocampal dentate gyrus of mice could increase the susceptibility of mice to stress and reduce the antidepressant eあect of total flavonoids of xiaobuxin decoction. Therefore, we used lentiviral vector to specifically express GSK3 in the dentate gyrus of hippocampus of mice in chronic stress model, and then treated with flavonoids of xiaobuxin decoction. The eあects of GSK3 overexpression on the antidepressant eあect of xbxt-2 in xiaobuxin decoction were evaluated by the behavioral changes such as forced swimming test and tail suspension test.

2. Materials and methods

2.1 Research design

All 58 male C57BL / 6N mice (weight 18g to 20g) were acceded to the laboratory environment for 1 week before the experiment. When the mice were divided into five groups, there was no statistical diあerence in body weight at the beginning of the experiment. 6 mice were kept in each cage, 12 hours of light / 12 hours of dark cycle, and the temperature was maintained at 22 ± 1 ℃. All mice were free to get food and water. The animal study was approved by the hospital's ethics committee and every eあort was made to reduce the number of animals used. Groups are arranged as following: (I) in the control group (10), (ii) of corticosterone group (； CORT) (10), (iii) of corticosterone + small bushing soup flavonoids (； CORT + XBXT - 2) group (10), (iv) of corticosterone flavonoids + + small bushing soup lentivirus no-load group (； CORT + XBXT - 2 + light) (14), (v) of corticosterone flavonoids + + small bushing soup lentivirus GSK3 beta express group (； CORT + XBXT - 2 + GSK3 beta) (14). In addition to the control group, other mice were injected with corticosterone (Sigma, 20 mg/kg) subcutaneously once a day for 22 days to induce depression in the mouse model. The control group was given subcutaneous injection of equal volume of normal saline. At the end of corticosterone injection, total flavones in xiaobuxin decoction were given to the stomach once a day, while distilled water was given to the control group and the CORT group.

2.2 Lentivirus mediated overexpression of gsk-3

Previous studies have shown sustained expression of lentiviral vectors when injected into the brain. In addition, since lentiviral vectors cannot replicate in vivo and cannot leave the injection site, they can be expressed locally and specifically [6]. The vector containing the nucleotide sequence of the target gene (GSK3) was constructed as follows: the protein coding region of the gsk-3 gene (GeneBank no. : BC006936.1) was amplified from the cDNA of the mouse brain by polymerase chain reaction (PCR) and cloned into the plvx-ires-zsgreen1 vector. The oligonucleotide primers for PCR amplification GSK3 beta: SpeI -s primer: 5 '- GGGACTAGTATGTCGGGGGCGACCGAGAAC - 3' and XbaI - A primer: 5 '- GGGTCTA GAGGTGGAGTTGGAAGCTGAT - 3', which carries the Spe I and Xba restriction enzymes loci. The following amplification conditions were used: 95 ℃ for 4 min； 95 ℃ 40 seconds, 53 ℃ 40 seconds, 72 ℃ 100 seconds, 35 cycles； Finally 72 ℃ continues to extend for 10 minutes. Transient co-transfection was performed to express plasmids (10 g), package vectors PMD2G (10 g) and psPAX2 (10 g) into 293T cells with 90% confluence. Gfp-positive cells were observed by fluorescence microscopy at 48 and 72 h after transfection, and the culture medium was collected. The cell fragments were removed by low-speed centrifugation and filtered by a 0.45 m filter. High titer lentivirus stock was prepared by centrifugation at 100,000 x g for 60 min. The viral precipitate was resuspended in phosphate buあer saline (PBS) containing 1% bovine serum albumin (BSA) and stored at -80 ℃. The QuickTiter TM lentivirus titer kit (Cell Biolabs, San Diego, California USA) was used to determine the lentivirus titer.

2.3 Animal surgery

Animals were anesthetized with 4% chloral hydrate (10 mg/kg) under peritoneum and placed in a stereotactic positioning device (st-51600, Kopf Instruments, Tujunga, USA). Ultramicropump II (Ultramicropump II) was injected into the hippocampal dentate gyrus at a rate of 0.2l/min. World Precision Instruments, Sarasota, FL, USA). Based on previous studies, the injection coordinate relative to the anterior fontanelle was ap-2.0. ML + / - 1.6； DV - 2.0. [7] the mice rested for 7 days after the injection to allow the virus to infect the cells at the injection site and start producing GSK3, or GFP protein. The GFP lentivirus group was the control of gsk-3 group with high expression. Six hours after the last dose of corticosterone, the mice were rapidly sacrificed to obtain hippocampal tissue for Western blot analysis. Primary antibodies included rabbit monoclonal antibodies gsk-3 propients (1:1000, CST, 9315S) and mouse monoclonal antineutroactin (1:2000, Sigma, A1978), and goat anti-mouse IgG (1:400, GeneScript) conjugated by peroxidase and goat anti-rabbit IgG (1:400, GeneScript).

2.4 Experimental detection indicators

The active behavior of mice was assessed by forced swimming test (FST) and suspended tail test (TST), respectively. Forced swimming test (FST) : in this study, each mouse was placed in a glass bucket (height × diameter: 25cm× 15cm), which contained water at a height of 20cm and kept at a temperature of 25 ± 1 ℃. The mice were allowed to swim for six minutes and the video was recorded for subsequent scoring. During the last four minutes, the duration of inactivity was scored, defined as a lack of activity other than movement to keep the mice's heads above water. Tail suspension test (TST) : tape the tail of the mouse from the base to the tip, covering 4/5 of the length, and fix it upside down on the hook. The score was then scored during the immobile period, which was defined as not making an active escape attempt in the last four minutes.

2.5 Statistical analysis

The data were expressed as mean ± standard deviation, and the statistical significance of the results was determined by one-way anova. The Tukey test was used for intra-group comparison. All statistical analyses were performed using SPSS version 21.0. P ＜ 0.05 was considered to be statistically significant.

3. Results

3.1 Verification of GSK3 overexpression in hippocampus

In order to detect the expression level of lentivirus in the brain tissue of mice after injection, 4 models were taken from group iv and group v on the 7th day after surgery, and the mice were sacrificed. Rt-pcr and western blot were used to analyze the gsk-3 expression induced by lentivirus vector in the hippocampus. Control mice were injected with a control viral vector expressing only GFP. The results showed that the mRNA levels of GSK3 mRNA in hippocampal tissue of mice treated with lentivirus GSK3 were 10.1 times higher than those treated with the control vector (table 1, figure 1A and B). P ＜ 0.005, n = 4), and the protein level of GSK3 increased by 6.3 times (table 1, figure 1C). P ＜ 0.005, n= 4). After determining the specific high expression of GSK3 in the hippocampal tissue of mice, subsequent behavioral and physiological analyses were conducted.

Table 1. Verification of GSK3 overexpression in hippocampal tissue

3.2 The total flavonoids of xiaobuxin decoction alleviated the depressive symptoms in mice

This study assessed depressive symptoms in mice by observing immobility in the forced swimming and tail suspension tests. In the forced swimming test, compared with the control group, the immobility time of CORT injection induced depression model mice (CORT group) was significantly increased (control group: 89±11.5 seconds vs CORT: 118±11.1 seconds, P＜0.05), while the immobility time was significantly reduced after treatment with total flavonoids of xiaobuxin decoction (CORT: 118±11.14 seconds vs CORT+ xbxt-2:90 ±12.1 seconds, P＜0.05). (table 2, figure 2) in the tail suspension test, compared with the control group, the imactivity time of the mice in the corticosterone-induced depression model was significantly increased (control group: 120±10.0 seconds vs CORT: 140±10.0 seconds, P＜0.05), while the imactivity time was significantly reduced after the treatment with total flavones of xiaobuxin decoction (CORT: 140±10.0 seconds vs CORT+ xbxt-2:12 0±7.0 seconds, P＜0.05). (table 2, figure 3)

3.3 The therapeutic effect of GSK3 on the inhibition of total flavonoids in xiaobuxin decoction

The no-load virus injection in the hippocampal dentate loop did not aあect the behavior pattern of the mice in the forced swimming test (CORT+ xbxt-2:90 ±12.1 seconds vs CORT+ xbxt-2 + no-load: 89±10.4 seconds, P＞0.05), but the injection of GSK3 lentivirus significantly inhibited the therapeutic eあect of total flavonoids in xiaobuxin decoction (CORT+ xbxt-2:90 ±12.1 seconds vs CORT+ xbxt-2 +GSK3:120±10.1 seconds, P＜0.05). (table 2, figure 2) in addition, the injection of no-load virus in the hippocampal dentate gyro did not affect the behavior pattern of the mice in the tail suspension test (CORT+ xbxt-2:12 0±7.0 seconds vs CORT+ xbxt-2 + no-load: 118±6.5 seconds, P＞0.05), but the injection of GSK3 with copd could significantly inhibit the therapeutic eあect of total flavonoids in xiaobuxin decoction (CORT+ xbxt-2:11 8±6.5 seconds vs CORT+ xbxt-2 +GSK3:140±10.8 seconds, P＜0.05). (Table 2, Figure 3)

Table 2. Comparison of immobile time of mice in forced swimming test and tail suspension test in each group

4. Discussion

In this study, the depression-like behavior of mice was induced by repeated corticosterone injection, and the model was used to further monitor the therapeutic eあect of total flavonoids in xiaobuxintang and the influence of overexpression of gsk-3 on the therapeutic eあect of total flavonoids in xiaobuxintang. It has been reported that the depression mouse model constructed by this method simulates the behavioral and neurochemical changes associated with depression, and is considered to be a convenient and reliable depression model [8]. In this study, it was shown that in corticosterone-induced depression-like mice, the total flavone of xiaobuxintang could significantly reduce its score in the behavioral assessment test (forced swimming test and tail suspension test), suggesting that the total flavone of xiaobuxintang had a better therapeutic eあect on depression in mice. Previous studies have shown that total flavonoids of xiaobuxin decoction have antidepressant eあects in normal mice or depressed model mice [9]. These results are consistent with the present study, which further confirmed the antidepressant activity of total flavonoids of xiaobuxin decoction on corticosterone-induced mouse depression model.

GSK3 plays an important role in the occurrence and development of depression, and the results of multiple transgenic animal models indicate a direct correlation between GSK3 and depression. GSK3 +/- mice exhibit behavioral eあects consistent with antidepressant - like effects and reduce amphetamine-induced hyperactivity. In addition, GSK3 knockout mice have increased susceptibility to amphetamine-induced hyperactivity and stress-induced depressionlike behavior [10-12]. Single injection of lentivirus expressing GSK3 shRNA into the hippocampal dentate gyrus of chronically stressed mice can silence the expression of GSK3 at the gene level, thus producing an antidepressant like eあect [13-14]. In addition, in vivo GSK3 overexpression induced the death of nerve cells, increased the number of reactive microglia cells in the hippocampal dentate gyrus of 3-month rats, and resulted in the atrophy of the hippocampal dentate gyrus of Tet/gsk-3 mice [15-16]. A recent study showed that overexpression of gsk-3 in mice induced nerve cell death and increased the number of nonfunctional microglia. The hippocampal volume of gsk-3 transgenic mice was significantly smaller than that of normal mice, possibly due to the premature death of nerve cells due to cell proliferation and failure of maturation/migration. Studies have shown that overexpression of gsk-3 induced significantly increased number of tunel-positive apoptotic cells in mouse nerve cells compared with the control group [17-18]. Previous studies showed that combination treatment with fluoxetine and risperidone can inhibit the GSK3 beta induced depression and anxiety and fluoxetine and imipramine joint to medicine can significantly increase in mice brain GSK3 beta serine phosphorylation, and serine phosphorylation of GSK3 beta is the activity of neural inhibitory molecule, is GSK3 beta main active protein form give play to the role of induced depression. The inhibition of GSK3 phosphorylation by these antidepressants occurs within a few hours after treatment in vivo, and the phosphorylation and dephosphorylation of proteins are very rapid, suggesting that the early molecular mechanism of drug treatment for depression is by inhibiting the serine phosphorylation of GSK3 phosphorylation [19-20]. This change was not discussed in this study, which is the shortcoming of this study. Further western blot experiments confirmed that the effect of total flavonoids in xiaobuxin decoction on phosphorylation of GSK3 serine can promote the development of this research field. In conclusion, this study confirmed the antidepressant activity of total flavonoids of xiaobuxin decoction in corticosterone-induced depression mouse model, and suggested that inhibition of gsk-3 in hippocampus might be one of its potential mechanisms.