Occurrence of Chlamydia spp. in wild birds in Thailand

Suksai Parut, Onket Rattanaporn, Wiriyarat Witthawat, Sangkachai Nareerat,Lekcharoen Paisin, Sariya Ladawan

1The Monitoring and Surveillance Center for Zoonotic Diseases in Wildlife and Exotic Animals, Faculty of Veterinary Science, Mahidol University, Salaya,Nakhon Pathom, Thailand

2Faculty of Veterinary Technology, Kasetsart University, Ngam Wong Wan Road, Lat Yao, Chatuchak, Bangkok, Thailand

3Department of Preclinical Sciences and Applied Animal Sciences, Faculty of Veterinary Science, Mahidol University, Nakhon Pathom 73170, Thailand

Keywords:Asian openbill stork Chlamydia spp.Wild bird

ABSTRACT Objective: To determine the occurrence of Chlamydia spp. in wild birds in Thailand.Methods: Cloacal and tracheal swabs of 313 wild birds from 11 orders, 27 families, and 51 species were tested to determine the occurrence of Chlamydia infection. The outer membrane protein A (ompA) gene was amplified from positive samples to construct a phylogenetic tree.Results: At the time of sample collection, none of the birds showed clinical signs of any disease. Of 313 wild birds, two Asian openbill stork (Anastomus oscitans) were positive for Chlamydia spp., representing 0.64% (2/313) and 4.9% (2/41) occurrence for birds overall and for the Asian openbill stork, respectively. Phylogram analysis based on deduced amino acid of the ompA gene showed that Chlamydia spp. in Asian openbill storks was closely related to that in wildfowl (Pica pica and Cygnus olor) from Poland in a different branch with a 95%bootstrap value and had a shorter evolutionary distance to Chlamydia abortus. Conclusions:Asymptomatic Asian openbill storks could be a potential source of Chlamydia infection in domestic animals, poultry, and humans who share their habitat.

1. Introduction

Chlamydosis is an infectious disease of several animal species,including wild birds and humans. The disease is caused by an obligate intracellular gram-negative bacteria in the family Chlamydiaceae. To date, Chlamydiaceae comprises 11 species,namelyChlamydiapsittaci(C. psittaci),Chlamydiafelis(C. felis),Chlamydiaabortus(C. abortus),Chlamydiaavium,Chlamydia caviae, Chlamydia gallinacea, Chlamydia muridarum,Chlamydia pecorum,Chlamydiasuis,Chlamydiapneumoniae, andChlamydia trachomatis, and three candidate chlamydial species, namelyChlamydiaibidis,Chlamydiasanzinia, andChlamydiacorallus[1-6].Within the chlamydial species,C. psittaci,C.felis, andC. abortushave zoonotic potential[7]. Chlamydiosis in birds can range from asymptomatic infection to severe disease with life-threatening illness, depending on the host species affected and the chlamydial species involved. Wild birds are important to public health because they can be infected withChlamydiaspecies that are transmissible to humans and domestic animals[8]. Several reports have shown the prevalence ofChlamydiain wild birds. In 2015, the positive rate for chlamydial DNA in wild birds in Poland was 7.3% (27/369)[9]. Two years later, a large number of wild birds in Poland were tested, and the results revealed Chlamydiaceae prevalence of 14.8% (132/894)[10]. Moreover, 10.3% (125/1 214) of wild birds in Austria and the Czech Republic have been found to beChlamydiaspp. positive[11].

The lowest prevalence was reported in Korea[12]. Only 2.7% (6/225)of wild birds in Korea were found to be positive toChlamydiaDNA;four (1.8%, 4/225) and two (0.9%, 2/225) were positive forC. psittaciandC. gallinacea, respectively[12]. In Thailand, a few studies have sought to detectChlamydiain wild birds. Of 407 feral pigeons, 44(10.8%) were positive for Chlamydiaceae, with most of the positive samplesC. psittaci[13]. One report examinedC. psittaciin captive psittacine birds and found 7.9% (14/178) prevalence[14]. Thus, the aim of this study is to determine the occurrence ofChlamydiaspp. in various species of wild birds in Thailand.

2. Materials and methods

2.1. Sample collection and genomic DNA extraction

During 2017-2018, tracheal and cloacal swabs of 313 wild birds from 11 orders and 51 species from seven provinces in Thailand were collected and examined (Table 1). The samples were kept in VB lysis buffer (Geneaid, Taiwan) and transferred to the laboratory in a cool chain within 48 hours. At the laboratory, genomic DNA was extracted from the samples using the viral nucleic acid extraction kit Ⅱ (Geneaid, Taiwan). The animal handling protocol used during sample collection and the samples used in this study were approved by the Animal Care and Use Committee of the Faculty of Veterinary Science, Mahidol University (Protocol No. MUVS-2017-02-04 and MUVS 2018-01-02).

2.2. Housekeeping gene detection

Before detection of Chlamydiaceae, the samples were examined the quality of the DNA by detection of the12S ribosomal(r) DNAhousekeeping gene using primers12S rDNA-F (5’GGATTAGATACCCCACTATGC 3’) and12S rDNA-R (5’AGGGTGACGGGCGGTATGTAC G 3’) and obtained a PCR product with a size of 436 bp[15]. In total a 25 μL, the PCR mixture contained 1× PCR buffer with 0.2 mM MgCl2, 2.5 units of i-TaqDNA polymerase (iNtRON, South Korea), 1 mM of dNTPs, 0.5 μM of each primer, and 3 μL of template DNA. The PCR reaction was worked under the conditions of 2 min at 94 ℃ for initial denaturing, followed by 30 cycles of 15 s at 94 ℃, 15 s at 60 ℃, and 30 s at 72 ℃, and was terminated at 72 ℃ for 7 min.

2.3. Chlamydiaceae detection

Chlamydiaceae was detected by primers CHY-F (5’GCCTACCGGCTTACCAAC 3 ’) and CHY-R (5 ’GGCGCAATGATTCTCGAT 3’) targeting the16S rRNAgene of the Chlamydiaceae family[16]. The PCR mixture contained 1 mM of dNTPs, 1× PCR buffer with 0.2 mM MgCl2, 2.5 units of i-TaqDNA polymerase (iNtRON, South Korea), 0.5 μM of each primer,and 3 μL of template DNA. Sterile DNase/RNase-free distilled water was added to increase the mixture to 25 μL. The PCR reaction was performed under the conditions of 2 min at 94 ℃ for initial denaturing, followed by 35 cycles of 15 s at 94 ℃, 30 s at 56 ℃, and 30 s at 72 ℃, and was terminated at 72 ℃ for 7 min. The primers generated a PCR product with a size of 230 bps.

2.4. ompA gene amplification and phylogenetic tree construction

The positive samples from the Chlamydiaceae detection protocol were used for amplification of theompAgene.TheompAgene was amplified with primers CTU (5’-ATGAAAAAACTCTTGAAATCGG-3’) and CTL (5’CAAGATTTTCTA GAYTTCATYTTGTT 3’). The primers generated a PCR product with a size of 1 070 bps[17]. The PCR mixture contained 3 μL of template DNA, 1× PCR buffer with 0.2 mM MgCl2, 1 mM of dNTPs, 2.5 units of i-TaqDNA polymerase(iNtRON, South Korea), and 0.5 μM each of forward and reverse primer. The PCR reaction was worked under the conditions of 2 min at 94 ℃ for initial denaturing, followed by 35 cycles of 30 s at 94 ℃, 30 s at 58 ℃, and 30 s at 72 ℃, and was terminated at 72 ℃ for 7 min. After that, DNA fragment of each sample was ligated to the pGEM-T easy vector (Promega, USA) and transformed to competentEscherichia coliTOP10 (InvitrogenTM, USA) using the calcium chloride method.Transformants were selected by blue-white screening method.Plasmid was extracted by the QIAprep spin miniprep kit (QIAGEN,Germany) and submitted to Macrogen Inc. (South Korea) for DNA sequencing. A phylogram of deduced amino acid sequences of theompAgene was generated by the maximum likelihood method and the JTT matrix-based model with a bootstrap value based on 1 000 replicates[18]. Evolutionary analyses were conducted with MEGA7 version 7.0 software[19].

3. Results

For all bird samples, the housekeeping gene (12S rDNA) was detected to examine the quality of the DNA. All samples were found to be positive for the12S rDNAgene, indicating the good quality of the DNA. For Chlamydiaceae detection, of 313 wild birds, two(0.64%) were positive for Chlamydiaceae with asymptomatic infection. These birds were Asian openbill storks (Anastomus oscitans), which belong to the order Ciconiiformes. The positive rate for Asian openbill storks was 4.9% (2/41). TheompAgene of the positive samples was amplified and sequenced. Nucleotide sequencing of theompAgene (Accession No. MK007613 and MK007614) in our study showed only 94.1% genetic similarity toChlamydiaspp. of Eurasian magpies (Pica pica) and mute swans(Cygnus olor) in Poland (Accession No. KX870484.1, KX424658.1,KX062052.1, KX062055.1). TheompAphylogenetic tree analysisshowed that theChlamydiaspp. detected in Asian openbill storks can be grouped together with 99% bootstrap support and was closely related toChlamydiaspp. detected in Eurasian magpies and mute swans in Poland but had a different cluster creation with a 95%bootstrap value (Figure 1). Additionally, theChlamydiaspp. found in this study had a closer relationship toC. abortusthan any other knownChlamydia.

Table 1 Details and number of wild birds tested in the study.

4. Discussion

Figure 1. Phylogenetic tree resulting from analysis of deduced amino acid sequences of the Chlamydiaceae ompA gene.

Wild birds may play a role as a potential source of Chlamydiaceae that can be transmitted to humans, domestic animals, and poultry[8,20,21]. In the present study, we demonstrated the overall occurrence ofChlamydiaspp. in several species of wild birds was 0.64%, suggesting low occurrence in wild birds in Thailand. The primers used in this study can detect Chlamydiaceae DNA as low as 1 fg, indicating high sensitivity of the test[16]. The occurrence found in the study was slightly lower than the rate in other countries,which ranges from 2.7% to 14.8%, depending on the bird species and detection method[9,10,12]. Phylogram-basedompAgene analysis of the positive samples found that theChlamydiadetected is closely related toChlamydiadetected/isolated in wildfowl in Poland and toC. abortus, which causes abortion and fetal death in ewes and goats, and abortion in women in close contact with aborting animals[7]. The wildfowlChlamydiastrains can presumably be classified as avianC. abortusbased on MLST analysis. However, the pathogenicity of the avianC. abortusstrains from wildfowl remains unknown[10]. The positive samples detected in our study were from Asian openbill storks in the order Ciconiiformes. A 4.9% prevalence level was found for these birds. Other species in Ciconiiformes were previously reported as having a Chlamydiaceae positive rate of 5.3% (2/38) for white storks[10] and 11.5% (13/113) for herons and allies[20], respectively. The variation of prevalence in Ciconiiformes may depend on the sample size of birds. However, to the best of the authors’ knowledge, Chlamydiaceae has not been previously reported in Asian openbill storks. The Asian openbill stork is a migratory bird, and the migration of Asian openbill stork populations along various migration pathways may be a potential means of spreading of Chlamydiaceae. Asymptomatic birds can transmit the bacterium to domestic birds and humans that share their environment or habitat or by handlingviafecal shedding and direct contact. In conclusion,this study demonstrates the occurrence ofChlamydiaspp. in wild birds in Thailand is 0.64%.Chlamydiaspp. in Asian openbill stork could be a potential source of infection in domestic animals, poultry,and humans who share their habitat.

Conflict of interest statement

The author declared that they have no conflict of interest.

Foundation project

This work was financially supported by the Faculty of Veterinary Science, Mahidol University. The sample used in this study were collected by the project of Establishment of zoonotic viral networking system: developmental phase; subproject of Influenza A virus surveys in migratory and residence birds of Thailand granting from Cluster and Program Management Office (P-15-50535), the National Science and Technology Development Agency, Thailand.