Expression and mechanism of miR-122 in rats with acute myocardial infarction

Wei-Bing Ni, Juan Cai, Fang-Qing Ge

1. Department of Cardiology

2. Radiology,Nantong Hospital of Traditional Chinese Medicine Jiangsu Nantong 226001

Keywords:

ABSTRACT

1. Introduction

Acute myocardial infarction (AMI) is a common clinical emergency in the department of cardiology. According to the epidemiology, more than half of the people who die from cardiovascular diseases die from AMI every year [1]. Studies have shown that a large number of myocardial cells are apoptotic after myocardial infarction, and ventricular remodeling resulting from this is an important pathological basis of heart failure after myocardial infarction and a major cause of death of patients [2]. MicroRNA (miRNA) is a class of highly conserved non-coding single-stranded small RNA with a length of about 18～25nt, which inhibits the transcription and translation of the target gene by binding to the 3 '-utr region of the target gene, thus participating in the regulation of various life processes such as cell proliferation, differentiation, apoptosis and aging [3]. MiRNA plays an important role in the occurrence and progression of cardiovascular diseases such as myocardial infarction, heart failure, ventricular remodeling and myocardial ischemia-reperfusion injury [4]. Mir-122 is the most abundant miRNA in the liver, accounting for about 72% of the total miRNA in the liver [5]. Circulating levels of mir-122 have been identified as clinical biomarkers for cirrhosis, liver injury, and hyperlipidemia. Recent studies by Li et al. showed that the level of mir-122 in peripheral blood is expected to be an indicator of transient ischemic attack [6], suggesting that mir-122 may be closely related to the development of cardiovascular disease. Although mir-122 plays an important regulatory role in lipid and carbohydrate metabolism in liver and cardiovascular diseases, its regulatory role in acute myocardial infarction has been rarely reported. The purpose of this study was to investigate the expression of mir-122 in rats with acute myocardial infarction and its possible mechanism of action.

2.Materials and methods

2.1 Experimental animals and materials

80 SPF grade male SD rats, aged 7 weeks and weighing 190 ～ 220g, were purchased from Beijing weitong liulian laboratory animal co., LTD. (license no. : SYXK (Beijing) 2017-0004) and kept in SPF grade animal houses with temperature of 25 ± 1 ℃, humidity of 55 ± 5% and 12h day and night. Rat cardiomyocyte H9C2 was purchased from the Shanghai cell bank of the Chinese academy of sciences. DMEM high glucose medium containing 10% fetal bovine serum and 1% penicillin streptomycin was cultured in an incubator at 37 ℃ with 5% CO2. Total RNA extraction kit, reverse transcription kit and rt-pcr kit were purchased from Takara, Japan. Plvx-gfp-ncshrna, plvx-gfp-mir-122-shrna lentivirus vector and paav-mir-122-shrna adenovirus vector were constructed by shandong weizhen biotechnology co., LTD. RIPA lysate and TUNEL cell apoptosis detection kit were purchased from biyuntian biotechnology co., LTD. The dual-luciferase reporter gene detection kit was purchased from Beijing quanshijinbiological co., LTD. XIAP, caspase-3 and caspase-7 antibodies were purchased from Abcam, UK.

2.2 Model construction of adenovirus injection and acute myocardial infarction

After one week of adaptive feeding in the animal house, SD rats were randomly divided into Sham group, AMI group, null virus group and virus group by digital table method, with 20 rats in each group. Rats in each group were anesthetized by intraperitoneal injection of 40mg/kg pentobarbital sodium and were fixed on the operating table in supine position. Endotracheal intubation was performed and the small animal ventilator was connected. The frequency was 90 times/min and the tidal volume was 10mg/kg. Subcutaneous electrodes were inserted into the right forelimb and the left hindlimb for ecg monitoring. The left xiphoid process was cut obliquely inward 1cm above the left of the left xiphoid process to expose the rib. The thoracic cavity was opened between the 3rd and 4th intercostals to separate the pericardium. After thawing, paavmir-122-shrna adenovirus and paav-mir-122-shrna adenovirus were fully mixed with PBS, and the transfected adenovirus vector was injected into the left ventricular cavity of rats in the aerovirus group and the virus group respectively, and PBS buffer was injected into other groups. After the injection, the anterior descending branch of the left coronary artery was ligated by thread at 2～3mm of the lower margin of the left atrial appendage of rats in AMI group, null virus group and virus group. The Sham group was threaded and not ligated. When the myocardium of the ligated rats became white, the dorsal arch of ST segment of the ecg increased ≥0.1mV and lasted for more than 15 minutes, it was considered that the myocardial infarction model was successfully constructed. Close the chest cavity, squeeze out excess gas, and suture the rats. After the rats resumed spontaneous breathing, the animal ventilator was shut off and the tracheal tube was removed. After modeling, penicillin was injected into the abdominal cavity of the rats to prevent infection.

2.3 Detection of cardiac function indicators

After 1 week of myocardial infarction modeling, the left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), left ventricular short-axis shrinkage rate (LVFS) and left ventricular ejection fraction (LVEF) of the rats in each group were detected by echocardiography after pentobarbiturate sodium anesthesia.

2.4 RT-PCR

After the detection of cardiac function, the rats were sacrificed. Cardiac tissue from the ligation line down to the apex of the heart was selected, and the total RNA of cardiac cells was extracted with the total RNA extraction kit of animal tissues, and the RNA integrity was detected by agar-gel electrophoresis. Total RNA was reversetranscribed to cDNA using reverse transcription kit. According to the nucleotide sequence of mir-122 in NCBI, rt-pcr primers were designed using Primer 5.0: mir-122-f: 5 '-ccttagcagagctgtggag-3'. MiR - 122 - R: 5 '- gcctagcagtagctatttag - 3'. U6: u6-f :5'-gtgctcgcttcggcagcac-3 '; U6-r: 5'-atatggaacgcttcacgaa-3 '. The reaction system was configured according to the instructions of rtpcr kit. The reaction parameters of rt-pcr were: denaturation at 95 ℃ for 20 seconds; Annealing at 60℃ for 30 seconds; 72℃ for 30 seconds, 40 cycles, and draw the melting curve. The 2 - Δ Δ Ct method of miR - 122 mRNA expression level relatively.

2.5 Detection of myocardial cell apoptosis

Rat myocardial tissue was sectioned by paraffin embedding, xylene was transparent, and gradient ethanol was dehydrated. Add 20 g/ml of protease K and incubate at room temperature for 30 min. Wash PBS 3 times. Incubate the 3% hydrogen peroxide solution at room temperature for 20 minutes. Wash PBS 3 times. Add 50 l biotin marker solution to the sample and incubate it for 60 min in the dark at 37℃. PBS was washed once, 0.2ml labeled reaction termination solution was added, and incubated at room temperature for 10 minutes. Wash PBS 3 times. Add 50 l streptavidin-hrp working liquid and incubate at room temperature for 30 min. Wash PBS 3 times. Add 0.3ml DAB color developing solution and incubate at room temperature for 5-30 minutes according to the color developing condition. Wash PBS 3 times. Dehydrate 95% ethanol for 5 minutes, dehydrate 100% ethanol for 3 minutes, repeat 2 times. Xylene was transparent for 5 minutes, repeated 2 times, sealed and observed. The brown color was tunel-positive apoptotic cells, and the apoptotic index = number of apoptotic cells/total number of cells ×100%.

2.6 Stable cell line construction

Logarithmic HEK293T cells were digested with trypsin and inoculated in 6-well plates. Lipofectamine 2000 was used to cotransfect nc-shrna and mir-122-shrna into the cells with plasmid. After 48h, cell culture supernatant was collected, the supernatant was centrifuged at 1000g, filtered by 0.45 m filter, and concentrated by PEG. Logarithmic H9C2 cells were inoculated in 6-well plates, and the supernatant of nc-shrna and mir-122-shrna virus were added to H9C2 cells, respectively, and the solution was changed after 48 hours. The uninfected cells were screened with purinomycin with a final concentration of 1 g/ml, and the remaining cells were expanded after removal of purinomycin when green fluorescence was expressed in all cells under fluorescence microscope. The expression level of mir-122 mRNA was detected by rt-pcr.

2.7 Luciferase reporter gene detection

Bioinformatics (http://www.targetscan.org/) analysis showed that XIAP is potential targets of miR - 122. Molecular cloning constructed a wild-type XIAP (xiap-wt) and mutant XIAP (xiapmut) luciferase reporter vector that was absent from the binding region of mir-122. Nc-shrna and mir-122-shrna cells were inoculated in 6-well plates, and xiap-wt and xiap-mut vectors were transfected into logarithmic nc-shrna and mir-122-shrna cells, respectively. The cells were collected 48 hours later, the cells were lysed with passive lysate and extracts were prepared. The relative luciferase activity of cells in each group was detected with the double luciferase reporter kit.

2.8 Western blot detection

2×106 nc-shrna and mir-122-shrna cells were collected, and 400 li of RIPA lysate was added to fully resuspend the cells. The cells were placed on the ice for 30 minutes. Centrifuge 12000g for 10 minutes, take the supernatant, add the SDS sample buffer, and cook at 100℃ for 10 minutes. Sds-page electrophoresis transfers the protein on PAGE adhesive to the PVDF membrane. 5% skim milk was sealed at room temperature for 1 hour. Anti-xiap antibody (1 g/ml), anticaspase-3 antibody (1 g/ml) and anti-caspase-7 antibody (1 g/ml) diluted in the blocking solution were added and incubated overnight at 4℃. Wash PBST 3 times for 5 minutes each time, add 1:500 diluted hrp-labeled secondary antibody, incubate at 37℃ for 1 hour, wash PBST 3 times for 5 minutes each time. The protein expression was detected by adding ECL chemiluminescence solution and protein gel imaging analyzer.

2.9 Statistical methods

SPSS23.0 was used for data analysis. The measurement data were expressed as mean ± standard deviation (x±s). The adoption rate of enumeration data (%) was expressed, and the 2 test was used for comparison between groups. P<0.05 means the difference is statistically significant.

3. Results

3.1 Comparison of mir-122 expression level

Rt-pcr results showed that the relative mRNA expression levels of mir-122 in myocardial tissues of rats in Sham group, AMI group, null virus group and virus group were 0.29±0.02, 1.28±0.09, 1.30±0.10 and 0.67±0.05, respectively. Compared with Sham group, mRNA expression levels of mir-122 in myocardial tissues of rats in AMI group and null virus group were significantly increased, suggesting that mir-122 may play an important role in cardiac function injury caused by myocardial infarction. Compared with the AMI group and the null virus group, the mRNA expression level of mir-122 in the myocardial tissue of rats in the virus group significantly decreased, with statistically significant differences (F=7.764, P=0.008), as shown in figure 1.

Figure 1 Comparison of miR-122 mRNA expression

3.2 Comparison of cardiac function indicators

Statistical data showed that after 2 weeks of myocardial infarction modeling, compared with Sham group, LVEDD and LVESD of rats in AMI group and null virus group were significantly increased, and LVFS and LVEF were significantly decreased, with statistically significant differences (P<0.05). Compared with the AMI group, LVEDD and LVESD of rats in the virus group decreased significantly, while LVFS and LVEF increased significantly (P<0.05), as shown in table 1. It suggested that the cardiac function of AMI rats was severely damaged, and down-regulation of mir-122 expression could significantly improve the cardiac function of AMI rats.

Tab. 1Comparison of cardiac function in rats(n=15,x±s)

3.3 Comparison of myocardial cell apoptosis level

TUNEL staining results showed that there were no tunel-positive cells in the Sham group, a large number of tunel-positive cells were found in the AMI group and the Sham virus group, and significantly fewer tunel-positive cells were found in the virus group. The results showed that compared with Sham group (7.53±0.59%), the apoptosis index of myocardial cells in AMI group and Sham virus group increased significantly (37.20±4.01%). 38.22 + 3.97); Compared with the AMI group, the apoptosis index of myocardial cells in the virus group (15.06±0.19%) decreased significantly (F=9.144, P=0.003), suggesting that the down-regulation of mir-122 significantly inhibited the apoptosis of myocardial cells in the AMI group, as shown in figure 2.

Fig.2 comparison of myocardial cell apoptosis in rats. The cell nucleus is shown in blue, and the amplification factor of TUNEL staining is shown in brown, with a resolution of 1000 DPI

3.4 Verification of the targeting relationship between mir-122 and XIAP

To further explore the possible role of mirna-122 in AMI myocardial cell apoptosis, we used bioinformatics to find that mirna-122a and 3’utr of XIAP mRNA have complementary regions, which may be a potential target of mirna-122, as shown in figure 3A. We verified the targeting relationship between mir-122-shrna cell lines and double luciferase reporter genes. The results showed that, compared with the nc-shrna cells (1.51±0.13), the expression level of mir-122 mRNA in mir-122-shrna cells significantly decreased (0.37±0.03) (t=6.736, P=0.011), indicating the successful construction of mir-122-shrna stable cell lines, as shown in figure 3B. Luciferase reporter assay showed that the relative luciferase activity of mir-122-shrna group (1.70±0.14) was significantly higher than that of nc-shrna group (0.46±0.04) (t=5.258, P=0.013) in overexpressed xiap-wt cells. In the cells that overexpressed xiap-mut, there was no significant difference in luciferase activity between the two groups (t=0.258, P=0.76), as shown in figure 3C.

Note: compared with nc-shrna cells, *P < 0.05

3.5 The effect of mir-122 on apoptosis-related proteins

Western blot results showed that the relative protein expression levels of XIAP, caspase-3 and caspase-7 in nc-shrna cells were (0.33±0.04). 2.25 + / - 0.18; 1.66 + 0.12); The relative protein expression levels of mir-122-shrna cells XIAP, caspase-3 and caspase-7 were (1.89±0.15). 061 + / - 0.05; 0.45 + / - 0.03). Compared with nc-shrna cells, the protein expression of XIAP in mir-122-shrna cells increased significantly (t=8.055, P=0.007), and the protein expression of caspase-3 and caspase-7 decreased significantly (t=6.218, P=0.012). T =6.933, P=0.010), see figure 4.

Figure 4 Effect of miR-122 on apoptosis-related proteins

4. Discussion

Mir-122 is mainly expressed in human liver, and is closely involved in various physiological and pathological processes such as liver cell proliferation, differentiation, lipid metabolism, stress, hepatotropic virus infection, non-alcoholic fatty liver disease, cancer occurrence, and inflammatory bowel disease [8,9]. Gao et al showed that the expression of mir-122 in the serum of patients with hyperlipidemia was significantly increased and was significantly correlated with the severity of coronary heart disease [10]. Wu et al. 's study also confirmed the increased expression of mir-122 in plasma of patients with acute coronary syndrome, which has reference value for the diagnosis of acute coronary syndrome [11]. The above results suggest that mir-122 may play a key regulatory role in the occurrence and development of coronary heart disease, but the relevant mechanism remains to be further studied. The results of this study showed that the expression level of mir-122 was significantly increased in myocardial tissues of rats with acute myocardial infarction, and the abnormal cardiac function index suggested that cardiac function of AMI rats was seriously damaged. However, after down-regulating the expression of mir-122, the cardiac function injury of AMI rats was significantly improved, suggesting that mir-122 plays an important role in the cardiac function injury of AMI rats.

Myocardial necrosis caused by acute and persistent ischemia and hypoxia in coronary arteries is an important cause of death in acute myocardial infarction. Myocardial cell apoptosis is an important physiological and pathological phenomenon occurring in myocardial infarction and non-infarction areas, and is also a key factor for irreversible damage to myocardial tissue [12]. MiRNA is an important regulator of myocardial cell apoptosis. Studies have shown that down-regulation of mir-122 expression can block the occurrence of apoptosis during myocardial infarction to a certain extent [13]. Our results show that the model of acute myocardial infarction in rat myocardial tissue apoptosis index increased significantly in the control group, the lower the expression of miR - 122 after AMI rats myocardial cell apoptosis level have obvious inhibition, show that the excessive expression may be indirect regulation of miR - 122 levels of myocardial cell apoptosis, which consistent with that of Zhang and others research results [14].

We constructed the mir-122-shrna cell line using rat cardiomyocytes to further explore the mechanism by which mir-122 affects the apoptosis of cardiomyocytes. Bioinformatics and luciferase reporter genes have shown that mir-122 can target and down-regulate the expression of XIAP (x-linked apoptotic inhibitor gene). XIAP is one of the strongest endogenous apoptotic inhibitory proteins in mammals, belonging to the apoptotic inhibitory protein family IAPs. It plays an anti-apoptotic role by directly binding to cysteine proteases such as caspase-3, caspase-7 and caspase-9 and specifically inhibiting their activation [15,16]. In addition, XIAP can inhibit cell apoptosis through the nuclear factor B pathway and signal transduction pathway [17]. Studies have shown that the protein expression of XIAP decreased and the activity of caspase-3 increased in adult rats after myocardial ischemia-reperfusion. XIAP may be involved in myocardial ischemia-reperfusion induced apoptosis by regulating caspase-3 [18]. Western blot was used to investigate the effect of mir-122 knockdown on apoptosis-related protein expression in cardiomyocytes. The results showed that compared with the ncshrna cells, the protein expression of XIAP in mir-122-shrna cells increased significantly, and the protein expression of caspase-3 and caspase-7 decreased significantly. It is suggested that mir-122 overexpression may promote the activation of caspase-3 and caspase-7 by targeting the down-regulation of XIAP expression, thus inducing the apoptosis of cardiomyocytes. In summary, the expression of mir-122 in the myocardial tissue of rats with acute myocardial infarction was significantly increased. Down-regulation of the expression of mir-122 may inhibit the apoptosis of myocardial cells through the XIAP/Caspase pathway, improve cardiac function damage, and provide important reference value for the clinical treatment of acute myocardial infarction.